nf-core/viralrecon
Assembly and intrahost/low-frequency variant calling for viral samples
Usage
Pipeline parameters
Please provide pipeline parameters via the CLI or Nextflow -params-file option. Custom config files including those provided by the -c Nextflow option can be used to provide any configuration except for parameters; see docs.
Samplesheet format
Illumina
You will need to create a samplesheet with information about the samples you would like to analyse before running the pipeline. Use this parameter to specify its location. It has to be a comma-separated file with 3 columns, and a header row as shown in the examples below.
--input '[path to samplesheet file]'Multiple runs of the same sample
The sample identifiers have to be the same when you have re-sequenced the same sample more than once e.g. to increase sequencing depth. The pipeline will concatenate the raw reads before performing any downstream analysis. Below is an example for the same sample sequenced across 3 lanes:
sample,fastq_1,fastq_2SAMPLE_1,AEG588A1_S1_L002_R1_001.fastq.gz,AEG588A1_S1_L002_R2_001.fastq.gzSAMPLE_1,AEG588A1_S1_L003_R1_001.fastq.gz,AEG588A1_S1_L003_R2_001.fastq.gzSAMPLE_2,AEG588A2_S4_L003_R1_001.fastq.gz,| Column | Description |
|---|---|
sample |
Custom sample name. This entry will be identical for multiple sequencing libraries/runs from the same sample. |
fastq_1 |
Full path to FastQ file for Illumina short reads 1. File has to be gzipped and have the extension “.fastq.gz” or “.fq.gz”. |
fastq_2 |
Full path to FastQ file for Illumina short reads 2. File has to be gzipped and have the extension “.fastq.gz” or “.fq.gz”. |
NB: Dashes (
-) and spaces in sample names are automatically converted to underscores (_) to avoid downstream issues in the pipeline.
Nanopore
You have the option to provide a samplesheet to the pipeline that maps sample ids to barcode ids. This allows you to associate barcode ids to clinical/public database identifiers that can be used to QC or pre-process the data with more appropriate sample names.
--input '[path to samplesheet file]'It has to be a comma-separated file with 2 columns. A final samplesheet file may look something like the one below:
sample,barcode21X983255,170H209408,249Y807476,370N209581,4| Column | Description |
|---|---|
sample |
Custom sample name, one per barcode. |
barcode |
Barcode identifier attributed to that sample during multiplexing. Must be an integer. |
NB: Dashes (
-) and spaces in sample names are automatically converted to underscores (_) to avoid downstream issues in the pipeline.
Nanopore input format
For Nanopore data the pipeline only supports amplicon-based analysis obtained from primer sets created and maintained by the ARTIC Network. The artic minion tool from the ARTIC field bioinformatics pipeline is used to align reads, call variants and to generate the consensus sequence.
Artic minion requires that you provide *.fastq files as input to the pipeline. These files can typically be obtained after demultiplexing and basecalling the sequencing data using Guppy (see ARTIC SOP docs). This pipeline requires that the files are organised in the format outlined below and gzip compressed files are also accepted:
.└── fastq_pass └── barcode01 ├── FAP51364_pass_barcode01_97ca62ca_0.fastq ├── FAP51364_pass_barcode01_97ca62ca_1.fastq ├── FAP51364_pass_barcode01_97ca62ca_2.fastq ├── FAP51364_pass_barcode01_97ca62ca_3.fastq ├── FAP51364_pass_barcode01_97ca62ca_4.fastq ├── FAP51364_pass_barcode01_97ca62ca_5.fastq <TRUNCATED>The command to run the pipeline would then be:
nextflow run nf-core/viralrecon \ --input samplesheet.csv \ --outdir <OUTDIR> \ --platform nanopore \ --genome 'MN908947.3' \ --primer_set 'artic' \ --primer_set_version 3 \ --fastq_dir fastq_pass/ \ --sequencing_summary sequencing_summary.txt \ -profile <docker/singularity/podman/conda/institute>Primer BED file format
As you may already know, one of nf-core/viralrecon’s steps is primer trimming, using a BED file with primer coordinates. If you are running the pipeline in amplicon mode (--protocol amplicon), you will then need to supply a BED file containing the primer positions by means of the --primer_bed parameter. This file is used by iVar for Illumina data and by artic minion for Nanopore data (if using --mapper_nanopore artic), but these two tools have different requirements:
- Illumina data: iVar accepts the file in either BED6 or BED7 format. Only the first 6 columns (chrom, start, end, name, score, strand) are required to soft clip primer sequences from the aligned BAM file.
- Nanopore data:
artic minionrequires the file to be in BED7 format, since this is required at the same time by primalbedtools’ bedfiles.py, which artic minion relies on for BED file processing. The 7th column indicates the primer sequence.
BED6 example:
MN908947.3 30 54 nCoV-2019_1_LEFT 60 -MN908947.3 385 410 nCoV-2019_1_RIGHT 60 +MN908947.3 320 342 nCoV-2019_2_LEFT 60 -MN908947.3 704 726 nCoV-2019_2_RIGHT 60 +BED7 example (as above, plus a 7th column indicating the primer sequence):
MN908947.3 30 54 nCoV-2019_1_LEFT 60 - ACCAACCAACTTTCGATCTCTTGTMN908947.3 385 410 nCoV-2019_1_RIGHT 60 + CATCTTTAAGATGTTGACGTGCCTCMN908947.3 320 342 nCoV-2019_2_LEFT 60 - CTGTTTTACAGGTTCGCGACGTMN908947.3 704 726 nCoV-2019_2_RIGHT 60 + TAAGGATCAGTGCCAAGCTCGTIf you plan to run the same primer set on both Illumina and Nanopore data, please supply a BED7 file if possible so that it works with both iVar and artic minion.
Illumina primer sets
The Illumina processing mode of the pipeline has been tested on numerous different primer sets. Where possible we are trying to collate links and settings for standard primer sets to make it easier to run the pipeline with standard parameter keys. If you are able to get permissions from the vendor/supplier to share the primer information then we would be more than happy to support it within the pipeline.
For SARS-CoV-2 data we recommend using the “MN908947.3” genome because it is supported out-of-the-box by the most commonly used primer sets available from the ARTIC Network. For ease of use, we are also maintaining a version of the “MN908947.3” genome along with the appropriate links to the ARTIC primer sets in the genomes config file used by the pipeline. The genomes config file can be updated independently from the main pipeline code to make it possible to dynamically extend this file for other viral genomes/primer sets on request.
For further information or help, don’t hesitate to get in touch on the Slack #viralrecon channel (you can join with this invite).
ARTIC primer sets
An example command using v3 ARTIC primers with “MN908947.3”:
nextflow run nf-core/viralrecon \ --input samplesheet.csv \ --outdir <OUTDIR> \ --platform illumina \ --protocol amplicon \ --genome 'MN908947.3' \ --primer_set artic \ --primer_set_version 3 \ --skip_assembly \ -profile <docker/singularity/podman/conda/institute>SWIFT primer sets
The SWIFT amplicon panel is another commonly used method used to prep and sequence SARS-CoV-2 samples. We haven’t been able to obtain explicit permission to host standard SWIFT primer sets but you can obtain a masterfile which is freely available from their website that contains the primer sequences as well as genomic co-ordinates. You just need to convert this file to BED6 format and provide it to the pipeline with --primer_bed swift_primers.bed. Be sure to check the values provided to --primer_left_suffix and --primer_right_suffix match the primer names defined in the BED file as highlighted in this issue. For an explanation behind the usage of the --ivar_trim_offset 5 for SWIFT primer sets see this issue.
An example command using SWIFT primers with “MN908947.3”:
nextflow run nf-core/viralrecon \ --input samplesheet.csv \ --outdir <OUTDIR> \ --platform illumina \ --protocol amplicon \ --genome 'MN908947.3' \ --primer_bed swift_primers.bed \ --primer_left_suffix '_F' \ --primer_right_suffix '_R' \ --ivar_trim_offset 5 \ --skip_assembly \ -profile <docker/singularity/podman/conda/institute>Running the pipeline
The typical command for running the pipeline is as follows:
nextflow run nf-core/viralrecon --input samplesheet.csv --outdir <OUTDIR> --genome 'MN908947.3' -profile dockerThis will launch the pipeline with the docker configuration profile. See below for more information about profiles.
Note that the pipeline will create the following files in your working directory:
work # Directory containing the nextflow working files<OUTDIR> # Finished results in specified location (defined with --outdir).nextflow_log # Log file from Nextflow# Other nextflow hidden files, eg. history of pipeline runs and old logs.If you wish to repeatedly use the same parameters for multiple runs, rather than specifying each flag in the command, you can specify these in a params file.
Pipeline settings can be provided in a yaml or json file via -params-file <file>.
Do not use -c <file> to specify parameters as this will result in errors. Custom config files specified with -c must only be used for tuning process resource specifications, other infrastructural tweaks (such as output directories), or module arguments (args).
The above pipeline run specified with a params file in yaml format:
nextflow run nf-core/viralrecon -profile docker -params-file params.yamlwith:
input: './samplesheet.csv'outdir: './results/'<...>You can also generate such YAML/JSON files via nf-core/launch.
Updating the pipeline
When you run the above command, Nextflow automatically pulls the pipeline code from GitHub and stores it as a cached version. When running the pipeline after this, it will always use the cached version if available - even if the pipeline has been updated since. To make sure that you’re running the latest version of the pipeline, make sure that you regularly update the cached version of the pipeline:
nextflow pull nf-core/viralreconReproducibility
It is a good idea to specify the pipeline version when running the pipeline on your data. This ensures that a specific version of the pipeline code and software are used when you run your pipeline. If you keep using the same tag, you’ll be running the same version of the pipeline, even if there have been changes to the code since.
First, go to the nf-core/viralrecon releases page and find the latest pipeline version - numeric only (eg. 1.3.1). Then specify this when running the pipeline with -r (one hyphen) - eg. -r 1.3.1. Of course, you can switch to another version by changing the number after the -r flag.
This version number will be logged in reports when you run the pipeline, so that you’ll know what you used when you look back in the future. For example, at the bottom of the MultiQC reports.
To further assist in reproducibility, you can use share and reuse parameter files to repeat pipeline runs with the same settings without having to write out a command with every single parameter.
If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles.
Core Nextflow arguments
These options are part of Nextflow and use a single hyphen (pipeline parameters use a double-hyphen)
-profile
Use this parameter to choose a configuration profile. Profiles can give configuration presets for different compute environments.
Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Apptainer, Conda) - see below.
We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported.
The pipeline also dynamically loads configurations from https://github.com/nf-core/configs when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to check if your system is supported, please see the nf-core/configs documentation.
Note that multiple profiles can be loaded, for example: -profile test,docker - the order of arguments is important!
They are loaded in sequence, so later profiles can overwrite earlier profiles.
If -profile is not specified, the pipeline will run locally and expect all software to be installed and available on the PATH. This is not recommended, since it can lead to different results on different machines dependent on the computer environment.
test- A profile with a complete configuration for automated testing
- Includes links to test data so needs no other parameters
docker- A generic configuration profile to be used with Docker
singularity- A generic configuration profile to be used with Singularity
podman- A generic configuration profile to be used with Podman
shifter- A generic configuration profile to be used with Shifter
charliecloud- A generic configuration profile to be used with Charliecloud
apptainer- A generic configuration profile to be used with Apptainer
wave- A generic configuration profile to enable Wave containers. Use together with one of the above (requires Nextflow
24.03.0-edgeor later).
- A generic configuration profile to enable Wave containers. Use together with one of the above (requires Nextflow
conda- A generic configuration profile to be used with Conda. Please only use Conda as a last resort i.e. when it’s not possible to run the pipeline with Docker, Singularity, Podman, Shifter, Charliecloud, or Apptainer.
-resume
Specify this when restarting a pipeline. Nextflow will use cached results from any pipeline steps where the inputs are the same, continuing from where it got to previously. For input to be considered the same, not only the names must be identical but the files’ contents as well. For more info about this parameter, see this blog post.
You can also supply a run name to resume a specific run: -resume [run-name]. Use the nextflow log command to show previous run names.
-c
Specify the path to a specific config file (this is a core Nextflow command). See the nf-core website documentation for more information.
Custom configuration
Resource requests
Whilst the default requirements set within the pipeline will hopefully work for most people and with most input data, you may find that you want to customise the compute resources that the pipeline requests. Each step in the pipeline has a default set of requirements for number of CPUs, memory and time. For most of the pipeline steps, if the job exits with any of the error codes specified here it will automatically be resubmitted with higher resources request (2 x original, then 3 x original). If it still fails after the third attempt then the pipeline execution is stopped.
To change the resource requests, please see the max resources and customise process resources section of the nf-core website.
Custom Containers
In some cases, you may wish to change the container or conda environment used by a pipeline steps for a particular tool. By default, nf-core pipelines use containers and software from the biocontainers or bioconda projects. However, in some cases the pipeline specified version maybe out of date.
To use a different container from the default container or conda environment specified in a pipeline, please see the updating tool versions section of the nf-core website.
Custom Tool Arguments
A pipeline might not always support every possible argument or option of a particular tool used in pipeline. Fortunately, nf-core pipelines provide some freedom to users to insert additional parameters that the pipeline does not include by default.
To learn how to provide additional arguments to a particular tool of the pipeline, please see the customising tool arguments section of the nf-core website.
Freyja
Freyja relies on a dataset of barcodes that use lineage defining mutations (see UShER). By default the most recent barcodes will be downloaded and used. However, if analyses need to be compared across multiple datasets, it might be of interest to re-use the same barcodes, or to rerun all Freyja analyses with the most recent dataset. To do this, specify the barcodes and lineages using the --freyja_barcodes, --freyja_lineages parameters, respectivly. The boostrapping of Freyja can be skipped by specifying --skip_freyja_boot.
Cutadapt
According to Cutadapt’s documentation regarding adapter types, you can have:
- Regular 3’ adapter:
-a ADAPTER- Set
--skip_noninternal_primerstotrue - Set
--threeprime_adapterstotrue
- Set
- Regular 5’ adapter:
-g ADAPTER- Set
--skip_noninternal_primerstotrue
- Set
- Non-internal 3’ adapter:
-a ADAPTERX:- Change
modules_illumina.config>PREPARE_PRIMER_FASTA>ext.argsto use$instead of^to add the X at the end of the sequence. - Set
--threeprime_adapterstotrue
- Change
- Non-internal 5’ adapter:
-g XADAPTER: This is the option by default.
nf-core/configs
In most cases, you will only need to create a custom config as a one-off but if you and others within your organisation are likely to be running nf-core pipelines regularly and need to use the same settings regularly it may be a good idea to request that your custom config file is uploaded to the nf-core/configs git repository. Before you do this please can you test that the config file works with your pipeline of choice using the -c parameter. You can then create a pull request to the nf-core/configs repository with the addition of your config file, associated documentation file (see examples in nf-core/configs/docs), and amending nfcore_custom.config to include your custom profile.
See the main Nextflow documentation for more information about creating your own configuration files.
If you have any questions or issues please send us a message on Slack on the #configs channel.
Running in the background
Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished.
The Nextflow -bg flag launches Nextflow in the background, detached from your terminal so that the workflow does not stop if you log out of your session. The logs are saved to a file.
Alternatively, you can use screen / tmux or similar tool to create a detached session which you can log back into at a later time.
Some HPC setups also allow you to run nextflow within a cluster job submitted your job scheduler (from where it submits more jobs).
Nextflow memory requirements
In some cases, the Nextflow Java virtual machines can start to request a large amount of memory.
We recommend adding the following line to your environment to limit this (typically in ~/.bashrc or ~./bash_profile):
NXF_OPTS='-Xms1g -Xmx4g'Enterovirus
nf-core/viralrecon has been extended to support Enterovirus typing through optimized BLASTN searches with taxonomic ID filtering.
The goal of this addition is to enable rapid and accurate Enterovirus strain/genotype identification directly from consensus sequences in the de novo assembly track, reducing BLASTN runtime while maintaining high typing accuracy.
Enterovirus profile and recommended params
The Enterovirus profile introduces specific adjustments compared to a standard viralrecon run, primarily to optimize strain/genotype typing.
By default, variant calling is deactivated for enterovirus typing because de novo assembly performs better through assembled contigs and BLAST comparison.
De novo assembly
De novo assembly is performed using spades and/or unicycler to generate contigs for BLASTN typing. Note that minia is not a default assembler for enterovirus.
BLASTN
Typing through blastn is performed through supplying a blast database with taxid mapping and a taxidlist, to improve typing specificity and reduce runtime.
The new optional parameter, --taxidlist, allows users to provide a list of NCBI Taxonomy IDs corresponding to Enterovirus taxa of interest.
Taxonomy IDs related to enterovirus can be retriewed through // Add command here
Example usage:
--blastdb path/to/blastdb--taxidlist path/to/taxidlist_taxids.txt--profile test_evReference genome
The default reference used in the enterovirus config of nf-core/viralrecon is the REFSEQ genome NC_002058.3 from NCBI of Enterovirus C. Given that a blast database is supplied, this reference is not significant for the de novo assembly. However, if no blast database is supplied, the reference genome will be used as reference for blast searches.
Users may provide their own custom reference genomes using the parameters:
--fasta <path_to_reference.fasta>--gff <path_to_annotation.gff>HIV
nf-core/viralrecon has been optimized to support HIV genome reconstruction and resistance detection.
This implementation takes inspiration from the parameterization used in the HIVdb pipeline at Stanford University.
The goal is to adapt the viralrecon framework to ensure accurate minor variant calling, reliable consensus sequence generation, and compatibility with resistance analysis tools for HIV.
HIV profile and recomended params
The HIV profile (-profile hiv) introduces specific adjustments compared to a standard viralrecon run, mainly in the variant calling and consensus generation steps, to align with the requirements of HIV resistance interpretation pipelines.
⚠️ By default, de novo assembly is deactivated for HIV as the resistance detection is only performed for the consensus genome through mapping approach, which has been already benchmarked agains Stanford’s HIVdb results.
Reference genome
The default reference used in the HIV config of nf-core/viralrecon is the one derived from the codfreq JSON profile. This reference has been specifically generated from the codfreq .json profile. By aligning to this codfreq-based reference, the resulting codon frequencies and codon coverages are directly comparable to those produced by HIVdb, ensuring accurate interpretation of resistance data.
However, users may provide their own custom reference genome using the parameters:
--fasta <path_to_reference.fasta>--gff <path_to_annotation.gff>When a custom reference is supplied, all variant calling, consensus generation, and resistance detection steps will use this user-defined reference.
⚠️ Note that this may produce results that are not directly comparable to those obtained with HIVdb. Users employing custom references do so at their own discretion and risk, as the chosen reference can affect the INDELs calling and their coverage and frequency.
Important: When performing HIV resistance detection, an annotation file (.gff) is mandatory. The GFF file is required to correctly annotate the pol gene regions (PR, RT and IN), which are essential for both sierra-local and codfreq analyses.
Available genome options
Two HIV genome references are distributed with viralrecon and can be selected using the --genome parameter:
--genome codfreq: The codfreq-derived reference (DEFAULT), generated from the original codfreq JSON annotation files. This reference ensures that codon-level frequency tables and coverage results are fully compatible with HIVdb and sierra-local resistance prediction outputs.--genome 'NC_001802.1': nextclade refeence, based on NC_001802.1 (HXB2 genome, K03455), the reference used by Nextclade for HIV-1 analysis.
HIV-specific parameters
The following parameters have been added to handle HIV resistance detection and related tools.
- General HIV resistance options:
perform_hiv_resistance: Whether to perform HIV resistance analysis or not.
- Options related with files required by
sierra-localsoftware for resistance detecton in HIV. If not provided, the files included with the software will be used.hivdb_xml: Path to the HIVdb ASI2 XML file. Updated files can be found here, where the different algorithm versions are stored. The one included in the software is the one withHIVDB_9.8.xmlname.apobec_drm: Path to the JSON HIVdb APOBEC DRM file. Updated files can be found here with theapobec_drms.jsonname.apobec_csv: Path to the CSV APOBEC file. Updated files can be found here with theapobecs.csvname.unusual_csv: Path to the CSV file used to determine unusual mutations. The file included with the software can be found here with the namerx-all_subtype-all.csvsdrms_csv: Path to the CSV file used to define SDRM mutations. Updated files can be found here with thesdrms_hiv1.csvname.mutation_csv: Path to the CSV file defining mutation types. Updated files can be found here with themutation-type-pairs_hiv1.csvname.
Nextclade configuration
The following default parameters are used in the --genome codfreq and --genome 'NC_001802.1' for Nextclade HIV-1 analysis. Make sure to update nextclade_dataset_tag to the latest one so the pipeline can download it.
nextclade_dataset_tag = '2025-09-09--12-13-13Z'nextclade_dataset_name = 'neherlab/hiv-1'nextclade_dataset = falseHIV-specific configuration
When using --genome 'codfreq' or --genome 'NC_001802.1' or --perform_hiv_resistance, which are activated in the -profile hiv configuration, the following configuration is activated by default.
Variant calling
Variant calling is performed using iVar variants with parameters optimized for HIV intra-host diversity:
- Variant frequency threshold:
0.01: Variants are called if their allele frequency is at least 1%, allowing detection of minority variants relevant for resistance analysis. - Minimum base quality:
30: Ensures reliability of detected variants. - Minimum depth of coverage:
50: Matches the minimum coverage used in HIVdb protocols to support robust variant calling.
Consensus generation
Consensus sequences are generated using iVar consensus, which supports ambiguous nucleotide codes, a key feature for HIV resistance interpretation tools.
The parameters are defined as follows:
- Frequency threshold:
0.9: A variant is included in the consensus until a position’s allele frequency is representing at least 90% of the allele frequency. This means that variants with frequencies below 50% may still be incorporated if necessary to achieve the 90% threshold in a given position. - Minimum base quality:
30 - Minimum depth of coverage:
50 - Low coverage regions:: Positions with fewer than 10 reads are masked as
N.
The user can change this configuration by providing a custom config file with -c param. This config file should contain this piece of code with the specific configuration for IVAR_VARIANTS and IVAR_CONSENSUS. RESISTANCE_REPORT’s ext.args2 should be the same as IVAR_CONSENSUS’s ext.args for the final report to contain the appropriate information.
process { withName: 'IVAR_CONSENSUS' { ext.args = '-t 0.9 -q 30 -m 50 -n N' } withName: 'IVAR_VARIANTS' { ext.args = '-t 0.01 -q 30 -m 50' } withName: 'RESISTANCE_REPORT' { ext.args2 = '-t 0.9 -q 30 -m 50 -n N' }}HIV resistance detection protocol
The detection of HIV drug resistance in nf-core/viralrecon is performed using the sierra-local software, complemented with codon-level frequency analysis generated by a modified version of codfreq.
This integrated approach ensures that both mutation interpretation and codon frequency information are available for downstream resistance reporting.
1. Sierra-local: HIV resistance prediction
sierra-local is a Python3 implementation of the Stanford University HIV Drug Resistance Database (HIVdb) Sierra web service.
It allows laboratories to generate HIV-1 drug resistance predictions locally, without the need to transmit patient data over a network. This provides full control over data provenance, security, and regulatory compliance.
Sierra-local computes drug resistance predictions directly from consensus HIV-1 sequences, producing JSON-formatted output that includes key resistance-associated mutations and drug susceptibility scores.
Within the HIV module of nf-core/viralrecon, sierra-local is executed using the consensus .FASTA file generated for each sample. The output is a .json file containing the main resistance data.
However, sierra-local operates at the codon level, and its JSON output does not include codon-level frequencies or codon depth information.
These additional metrics are crucial for resistance reporting and neeed consistency with other viralrecon outputs, which are based on nucleotide-level variant calls.
2. Codon-level frequency analysis with codfreq
To obtain codon frequency information, nf-core/viralrecon integrates a modified version of codfreq tool.
The modified version of codfreq produces a codon frequency table in the CodFreq format, which contains seven columns:
| Column | Description |
|---|---|
gene |
HIV gene (PR, RT, or IN) |
position |
Codon position at protein level |
total |
Total reads covering that position (tiplet) |
codon |
Nucleotide triplet or INDELS |
count |
Total reads supporting that codon |
total_quality_score |
Qualituy score of that codon assigned by codfreq |
aa_codon |
If the codon is multiple of 3, the corresponding aminoacid sequence |
This format enables codon-level analysis of intra-sample diversity.
However, codfreq requires a custom JSON file that describes the HIV gene structure (PR, RT, and IN). To generate this JSON dynamically according to the user’s selected reference genome, several preprocessing steps are performed.
3. Generation of codfreq annotation JSON
The generation of the required JSON file for codfreq involves the following steps:
-
Conversion of reference annotations: The original codfreq HIV profile (in JSON format) has been converted into a
.fastaand.gfffile containing the necessary annotations for PR, RT, and IN genes. These files are included withinnf-core/viralreconassets. -
Reference genome alignment with Liftoff: Only performed when the provided genome is not the one from codfreq. Using the provided reference genome and the
.fastaand.gfffrom the step 1, annotation files are processed with Liftoff to transfer the HIV gene annotations to the user’s specific reference genome. -
Custom JSON generation: The annotated
.gfffile and the reference.fastaare used as input for a custom Python scriptbin/gff2json.pywithinnf-core/viralrecon. This script produces the JSON file required bycodfreq, ensuring accurate gene coordinates and consistency with the reference genome. -
Annotation harmonization for variant mapping: Only performed when the provided genome is not the one from codfreq. Once the new
.gfffile is produced by Liftoff, an additional annotation step is performed. The variant caller outputs (based on nucleotide-level variants) are re-annotated using this updated.gff, generating a secondary annotation layer. This process allows a direct mapping between codon-based resistance results (fromsierra-localandcodfreq) and nucleotide-based variant calls, ensuring that both analyses can be compared and integrated accurately in downstream reviews.
This automated workflow guarantees that the codfreq JSON file always matches the user-defined HIV reference, maintaining compatibility with both sierra-local and the consensus sequence data.
4. Integration of codfreq with mapped reads
Once the annotation JSON is generated, the mapped BAM files and the codfreq JSON are processed using a modified version of codfreq within the pipeline.
This version has been adapted to work seamlessly with nf-core/viralrecon output formats and file structures.
The result is a set of .codfreq tables containing codon-level read frequencies for PR, RT, and IN genes, harmonized with the annotation used by Sierra-local.
5. Integration and final reporting
Finally, the outputs from sierra-local (.json) and codfreq (.codfreq) are merged to produce custom HIV resistance summary tables.
The resulting integrated reports provide a comprehensive view of HIV drug resistance, maintaining compatibility with established databases and ensuring consistency with the rest of the viralrecon analytical framework.
To know more about the output files generated in the HIV resistance steps, check the output documentation.